The most gorilla gorilla that ever gorillaed.
Shit, here we go again.
That’s Grape Ape. I suspect you wanted Magilla Gorilla
nope, purposefully the purple beast. i was goin for the ape consonance
For a long time humans were classified as homo sapien sapien
Wait, they took one of our sapiens? The bastards!
Not that I’ve heard of. Now, whether Homo sapiens idaltu is a real separate species from Homo sapiens sapiens is disputed, so there’s a question as to whether the second sapiens actually differentiates us from anything… but I haven’t seen any signs of any consensus against calling ourselves Homo sapiens sapiens to date.
OP missed a good opportunity to title this post “goriginallity”

gorilla together stronger
That’s how gorillas pronounce their name
If you have a problem with neurodivergent ape namers, please understand that you’re wrong wrong wrong.
some one tell him about Buffalo
Buffalo buffalo Buffalo buffalo buffalo buffalo Buffalo buffalo.
Gorilla gorilla, Gorilla gorilla gorilla, gorilla Gorilla gorilla
Ignoring capitalisation you can add as many buffalos as you like and still be parsable. I’ve only ever heard buffalo used as a verb in this one context, though, so seems a bit forced to me
The scuttlebutt is that buffalo as a verb was only attested very briefly in upstate New York and the Midwest for a brief period of time in the early 1900s. It never spread nationally, and definitely not internationally.
However, checking Google ngrams shows that “he buffaloed” and “was buffaloed”, (to ensure it’s being used idiomatically as a verb and not just in the famous example sentence) emerged in 1900, peaked in the 1950s, but has sustained small but constant use in published print since then. I was actually expecting the ngram to rapidly drop off and never recover… shocked to see that some people still use it as a real phrase.
You’re doing the lord’s work
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
That’s really interesting, thanks for sharing
I mean, just look at 'em
10/10 gorilla
It’s the gorillast of them all

I miss those days, now it’s all boring version control
My junior’s commit messages look like this image. There’s always a way.
The Gen Z translation is “Gorilla fr” and “Gorilla frfr”
Because we biologists fucking SUCK at naming things.








